CRISPResso2 is a software pipeline for the analysis of genome editing experiments. It is designed to enable rapid and intuitive interpretation of results produced by amplicon sequencing.
CRISPResso automatizes and performs the following steps summarized in the figure below:
Allocate an interactive session and run the program. This example runs through the test suite supplied by the developer. Example commands can be found within the testRelease.sh script.
Sample session (user input in bold):
[user@biowulf crispresso]$ sinteractive -c2 --mem=4g --gres=lscratch:10 salloc.exe: Pending job allocation 11290667 salloc.exe: job 11290667 queued and waiting for resources salloc.exe: job 11290667 has been allocated resources salloc.exe: Granted job allocation 11290667 salloc.exe: Waiting for resource configuration salloc.exe: Nodes cn0863 are ready for job srun: error: x11: no local DISPLAY defined, skipping error: unable to open file /tmp/slurm-spank-x11.11290667.0 slurmstepd: error: x11: unable to read DISPLAY value [user@cn0863 crispresso]$ cd /lscratch/$SLURM_JOB_ID [user@cn0863 11290667]$ git clone https://github.com/pinellolab/CRISPResso2.git Cloning into 'CRISPResso2'... remote: Enumerating objects: 57, done. remote: Counting objects: 100% (57/57), done. remote: Compressing objects: 100% (44/44), done. remote: Total 1118 (delta 29), reused 26 (delta 12), pack-reused 1061 Receiving objects: 100% (1118/1118), 1.53 MiB | 0 bytes/s, done. Resolving deltas: 100% (783/783), done. [user@cn0863 11290667]$ cd CRISPResso2/tests/ [user@cn0863 tests]$ git checkout v2.2.14 Note: checking out 'v2.2.14'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by performing another checkout. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -b with the checkout command again. Example: git checkout -b new_branch_name HEAD is now at 4598226... HDR Updates - yw #82 [user@cn0863 tests]$ module load crispresso [+] Loading crispresso 2.2.14 on cn0863 [+] Loading singularity 3.10.5 on cn0863 [user@cn0863 tests]$ ./testRelease.sh Running CRISPResso Running CRISPResso with parameters Running CRISPRessoBatch [user@cn0863 tests]$ exit exit srun: error: cn0863: task 0: Exited with exit code 255 salloc.exe: Relinquishing job allocation 11290667 salloc.exe: Job allocation 11290667 has been revoked. [user@biowulf crispresso]$
Create a batch input file (e.g. crispresso.sh). For example:
#!/bin/bash set -e module load crispresso SEQ=CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG CRISPResso -r1 FANC.Cas9.fastq -a $SEQ -g GGAATCCCTTCTGCAGCACC
Submit this job using the Slurm sbatch command.
sbatch [--cpus-per-task=#] [--mem=#] crispresso.sh
Create a swarmfile (e.g. crispresso.swarm). For example:
CRISPResso -r1 A.fastq -a $SEQ -g GGAATCCCTTCTGCAGCACC CRISPResso -r1 B.fastq -a $SEQ -g GGAATCCCTTCTGCAGCACC CRISPResso -r1 C.fastq -a $SEQ -g GGAATCCCTTCTGCAGCACC CRISPResso -r1 D.fastq -a $SEQ -g GGAATCCCTTCTGCAGCACC
Submit this job using the swarm command.
swarm -f crispresso.swarm [-g #] [-t #] --module crispressowhere
| -g # | Number of Gigabytes of memory required for each process (1 line in the swarm command file) |
| -t # | Number of threads/CPUs required for each process (1 line in the swarm command file). |
| --module crispresso | Loads the crispresso module for each subjob in the swarm |